Skip to main content

Table 5 Real-time PCR primer sequences for genes of interest

From: The effect of short-term canola oil ingestion on oxidative stress in the vasculature of stroke-prone spontaneously hypertensive rats

Gene Forward primer (5'-3') Reverse primer (5'-3')
NOX 2 TCA AGT GTC CCC AGG TAT CC CTT CAC TGGCTGTACCAAAGG
p22phox GCT CAT CTG TCT GCT GGA GTA ACGACCTCATCTGTCACTGGA
CuZn-SOD TGTGTCCATTGAAGATCGTGTGA TCTTGTTTCTCGTGGACCACC
Mn-SOD TTAACGCGCAGATCATGCA CCTCGGTGACGTTCAGATTGT
Ec-SOD GGCCCAGCTCCAGACTTGA CTCAGGTCCCCGAACTCATG
  1. The primers were all obtained from previous published sequences and were ordered through Geneworks (Australia): NOX2 [37], p22phox [35], CuZn-SOD, MnSOD and Ec-SOD [36].