Skip to main content

Table 1 Primers and fluorescent probes for real-time RT-PCR

From: TO901317 regulating apolipoprotein M expression mediates via the farnesoid X receptor pathway in Caco-2 cells

Gene Forward primer Reverse primer Probe
GAPDH ggaaggtgaaggtcggagtc cgttctcagccttgacggt 5'-FAM-tttggtcgtattgggcgcctg-TAMRA
ApoM tgccccggaaatggatcta cagggcggccttcagtt 5'-FAM-cacctgactgaagggagcacagatctca-TAMRA
ApoA1 ctgggataacctggaaaaggagac ggaagtcgtccaggtagggct 5'-FAM-agatgagcaaggatctggaggaggtgaa-TAMRA
SHP1 aaagggaccatcctcttcaacc agggttccaggacttcacacag 5'-FAM-cctccaagccgcctcccacatt-TAMRA
LRH-1 ttagtggcaaaacttcgttctctcc agggcggcattgacttgttc 5'-FAM-agttcgtatgtctgaaattcttggtgctct-TAMRA
ABCA1 caaggggtaggagaaagagacgc ctcagccagcacccccag 5'-FAM-ccagccacggcgtccctgctgt-TAMRA