Skip to main content

Table 1 Primers used for real-time PCR analysis

From: Simvastatin reduces atherogenesis and promotes the expression of hepatic genes associated with reverse cholesterol transport in apoE-knockout mice fed high-fat diet

Gene Primer Sequence (5`-3`)
ABCA1 Sense CGTTTCCGGGAAGTGTCCTA
  Anti-sense GCTAGAGATGACAAGGAGGATGGA
ABCG1 Sense GGGAAGTTGATAAAGGATGT
  Anti-sense GATTCGGGCTATGTATGG
SR-BI Sense ATCTGGTGGACAAATGGAA
  Anti-sense GAAGCGATACGTGGGAAT
apoA-I Sense GGCACGTATGGCAGCAAGAT
  Anti-sense CCCAGAAGTCCCGAGTCAAT
apoA-II Sense CCAAGGCATACTTTGAGAAGACAC
  Anti-sense GGAGAAAACAGGCAGAAGGTAGG
LCAT Sense CCCACCAGCAGGATGAATACTAC
  Anti-sense AGGCTATGCCCAATGAGGAA
ABCG5 Sense AGCGTCAGCAACCGTGTC
  Anti-sense AGCAGCGTGGTCTTCCCT
ABCG8 Sense TTAAGCCACTCCCAATACA
  Anti-sense GTTGCTCCAAGAATAAATGA
ABCB11 Sense CAAATAAGGTTGTGGGTAA
  Anti-sense AGGACTGACAGCGAGAAT
ABCB4 Sense CCCCACAGAGGGTAAGAT
  Anti-sense CCAACCAGGGTGTCAAAT
LXRα Sense TTTGAGCAGCGTCCATTC
  Anti-sense GCAGTCAGTGAGCCTTCG
GAPDH Sense TGACGTGCCGCCTGGAGAAA
  Anti-sense AGTGTAGCCCAAGATGCCCTTCAG