Skip to main content

Table 1 Primers for quantitative RT-PCR

From: 4,8-Sphingadienine and 4-hydroxy-8-sphingenine activate ceramide production in the skin

Gene Primer sequence (Forward) Primer sequence (Reverse) Reference
SPTLC2 CCAGACTGTCAGGAGCAACCATTA CGTGTCCGAGGCTGACCATA  
CerS2 CCGATTACCTGCTGGAGTCAG GGCGAAGACGATGAAGATGTTG [12]
CerS3 ACATTCCACAAGGCAACCATTG CTCTTGATTCCGCCGACTCC [12]
CerS4 CTTCGTGGCGGTCATCCTG TGTAACAGCAGCACCAGAGAG [12]
CerS5 GCCATCGGAATCAGGAC GCCAGCACTGTCGGATGT [12]
CerS6 GGGATCTTAGCCTGGTTCTGG GCCTCCTCCGTGTTCTTCAG [12]
DEGS-1 GCGTTTGGCAGTTGCATTAA CATTGTGGGCAATCTCATGAA designed by Primer Express
SMS-1 GCCAGGACTTGATCAACCTAACC CCATTGGCATGGCCGTTCTTG [13]
SMS-2 CACCCAGTGGCTGTTTCTGA TGCATTCCAGGCACAGGTAGA [13]
aSMase TGGCTCTATGAAGCGATGGC TTGAGAGAGATGAGGCGGAGAC [14]
β-GCS GCTAGGCTCCTGGGATCGAG GTTCAGGGCAAGGTTCCAGTC [15]
GCS GTTCGTCCTCTTCTTGGTGC AGAAGAGAGACACCTGGGAGC [16]
ELOVL-1 ATTCTCCTGACCTACGTGTACTT TTCCGATTAGCCATGATGCGA Primer Bank
ELOVL-4 CATGTGTATCATCACTGTACG AAAGGAATTCAACTGGGCTC [17]
ELOVL-5 TAACAGGAGTATGGGAAGGCA ACCAGAGGACACGGATAATCTT Primer Bank
ELOVL-6 TGCTGCCTTTATATTCGGTGG CCTCAGTTCAAACTTTGCTCGTT Primer Bank
ELOVL-7 TTCCATCATACCATCATGCC CCCAATGCAGAAAGTCCATA [18]
PPARβ/δ ACAGCATGCACTTCCTTCCA TCACATGCATGAACACCGTA [19]
PPARγ ATTCTGGCCCACCAACTTTG TCCATTACGGAGAGATCCACG [20]
GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG [21]
  1. Primer sequences used in real-time quantitative RT-PCR in this study. All primers were used with SYBR-Green and their specificities checked using the melting curve method (60–95°C).