Skip to main content

Table 1 Primers for RT-PCR

From: Saturated fatty acid palmitate-induced insulin resistance is accompanied with myotube loss and the impaired expression of health benefit myokine genes in C2C12 myotubes

Gene Forward primer (5–3) Reverse primer (5–3)
Glut4 TCTCAATGGTTGGGAAGGAAA GAACCGTCCAAGAATGAGTATCTC
MCK CGGCTTCACTCTGGACGATG TCTTATGCTTGTCTGTGGGTTTGT
myogenin CCTGGAAGAAAAGGGACTGG CGCTCAATGTACTGGATGGC
MHC1 CTCAAGCTGCTCAGCAATCTATTT GGAGCGCAAGTTTGTCATAAGT
MHC2b CAATCAGGAACCTTCGGAACAC GTCCTGGCCTCTGAGAGCAT
FNDC5 CAGAAGAAGGATGTGCGGATGC ACAGGCTCACTGGCTGGGCTCT
CTRP15 CCCCTTTATCCCATCTGAGGTTCTGC GGCTACCCGAGGCTGGTGTAGTGAG
FGF21 GGAGATCAGGGAGGATGGAAC TGGCTGTTGGCAAAGAAACC
IL6 GTTGCCTTCTTGGGACTGATG CTGGCTTTGTCTTTCTTGTTATC
Atrogin1 CATCCCTGAGTGGCATCG GAGTCTGGAGAAGTTCCCGTAT
MuRF1 ATCCTGCCCTGCCAACAC CGGAAACGACCTCCAGACAT
18S TTGACGGAAGGGCACCACCAG GCACCACCACCCACGGAATCG