Skip to main content

Table 2 Real-time PCR primer sequences

From: Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members

Gene Primer sequences Genebank number
SR-A1 Forward: CCAGGGACATGGGAATGCAA NM_138715.2
Reverse: CCAGTGGGACCTCGATCTCC
CD36 Forward: GAGAACTGTTATGGGGCTAT NM_001001548.2
Reverse: TTCAACTGGAGAGGCAAAGG
ABCA1 Forward: GCACTGAGGAAGATGCTGAAA NM_005502.2
Reverse: AGTTCCTGGAAGGTCTT GTTC
ApoAI Forward: TGTGTCCCAGTTTGAAGGC NM_000039.1
Reverse: CTCCTTTTCCAGGTTATCCCAG
PPARγ Forward: CACAAGAACAGATCCAGTGGTTGCAG NM_005037.5
Reverse: AATAATAAGGTGGAGATGCAGGCTCC
Cidea Forward: GGGATCACAGACTAAGCGAG NM_001279.3
Reverse: TGACGAGGGCATCCAGAG
Cideb Forward: TGATGGTGTTGCAGTCTGG NM_014430.2
Reverse: AAAGAGGTCTCGAGGGTTTTG
Cidec Forward: TTGATGTGGCCCGTGTAACGTTTG NM_022094.2
Reverse: AAGCTTCCTTCATGATGCGCTTGG
Perilipin Forward: GCCATGTCCCTATCAGATGC NM_001145311.1
Reverse: GTTGTCGATGTCCCGGAATT
ADRP Forward: CTGAGCACATCGAGTCACATACTCT NM_001122.2
Reverse: GGAGCGTCTGGCATGTAGTGT
TIP47 Forward: GCTGGACAAGTTGGAGGAGA NM_001164189.1
Reverse: CCGACACCTTAGACGACACA
S3-12 Forward: ACATCTTCCACCCCATGAATG NM_001080400.1
Reverse: GTGTTCAAATGCCCGCTG
LSDP5 Forward: AGCACGATGTCTGAAGAAGAG DQ_839131.1
Reverse: TCCTTGGCTGCACTGTAAAC
HPRT1 Forward: TGACACTGGCAAAACAATGCA NM_005502.2
Reverse: GGTCCTTTTCACCAGCAAGCT