Skip to main content

Table 1 Primers used for real-time PCR analysis

From: Acute stress show great influences on liver function and the expression of hepatic genes associated with lipid metabolism in rats

Gene Primer Sequence(5′ → 3′)
SR-BI Sense CCCCATGAACTGTTCCGTGA
  Anti-sense CCACAGCAATGGCAGGACTA
ABCG5 Sense GGGAAGTGTTTGTGAACGGC
  Anti-sense GTGTATCTCAGCGTCTCCCG
ABCG8 Sense ACGTGGACTTGACGAGCATT
  Anti-sense GTGTCCTGTGTGAGGGTCTG
GAPDH Sense TGCTGGGGCTGGCATTGCTCTC
  Anti-sense ATGAGGTCCACCACCCTGTTGC