Mammary inflammation around parturition appeared to be attenuated by consumption of fish oil rich in n-3 polyunsaturated fatty acids

Table 5 PCR product sequences of oligonucleotide primers used to amplify cytokines and a house keeping gene

Gene		Primer sequences(5′-3′)	Products size	Genebank accession number
IL-1β	Forward	tgacctgttctttgaggctgac	113 bp	M98820.1
	Reverse	cgagatgctgctgtgagatttg
TNF-α	Forward	ccactctgacccctttactctga	154 bp	NM_013693.2
	Reverse	ctgtcccagcatcttgtgtttc
IL-8	Forward	ccagcaggaaaccagaagaaag	123 bp	NM_001173399.2
	Reverse	caactttgtcacgaccataccc
IL-10	Forward	gctggacaacatactgctgaca	112 bp	NM_012854.2
	Reverse	ctggggcatcacttctaccag
PPAR-γ	Forward	gccctttggtgactttatggag	170 bp	NM_013124.3
	Reverse	gcagcaggttgtcttggatgt
XOR	Forward	gattctcacacacctcctgacg	156 bp	NM_011723.2
	Reverse	ccccacacacacacacacactat
β-actin	Forward	ctgtgtggattggtggctctatc	133 bp	NM_031144.2
	Reverse	gctcagtaacagtccgcctagaa

ISSN: 1476-511X