Skip to main content

Table 5 PCR product sequences of oligonucleotide primers used to amplify cytokines and a house keeping gene

From: Mammary inflammation around parturition appeared to be attenuated by consumption of fish oil rich in n-3 polyunsaturated fatty acids

Gene   Primer sequences(5′-3′) Products size Genebank accession number
IL-1β Forward tgacctgttctttgaggctgac 113 bp M98820.1
  Reverse cgagatgctgctgtgagatttg   
TNF-α Forward ccactctgacccctttactctga 154 bp NM_013693.2
  Reverse ctgtcccagcatcttgtgtttc   
IL-8 Forward ccagcaggaaaccagaagaaag 123 bp NM_001173399.2
  Reverse caactttgtcacgaccataccc   
IL-10 Forward gctggacaacatactgctgaca 112 bp NM_012854.2
  Reverse ctggggcatcacttctaccag   
PPAR-γ Forward gccctttggtgactttatggag 170 bp NM_013124.3
  Reverse gcagcaggttgtcttggatgt   
XOR Forward gattctcacacacctcctgacg 156 bp NM_011723.2
  Reverse ccccacacacacacacacactat   
β-actin Forward ctgtgtggattggtggctctatc 133 bp NM_031144.2
  Reverse gctcagtaacagtccgcctagaa