Skip to main content

Table 1 Oligo-nucleotide primer pairs for detecting of genes promoter methylation and mRNA expression

From: Betaine supplement alleviates hepatic triglyceride accumulation of apolipoprotein E deficient mice via reducing methylation of peroxisomal proliferator-activated receptor alpha promoter

Gene symbol Primer sequence(5-3) Anneal temperature Amplicon size
PPARa M F: TTTTTACG AATTTTCG GGATTC 55 164
  R: AAAAAATACG CCTTAACGCG   
PPARa U F: TTTTTTTATGAATTTTTGGGATTTG 55 169
  R: TAAAAAAAATACACCTTAACACACA   
PPARa F: GGGCAAGAGAATCCACGAAG 60 91
  R: GTTGTTGCTGGTCTTTCCCG   
CYP2E1 F: TGCAGTCCGAGACAGGATGA 60 82
  R: GGAAGGGACGAGGTTGATGA   
CPT1 F: AGCACACCAGGCAGTAGCTT 60 144
  R: AGGATGCCATTCTTGATTCG   
UCP2 F: TCTCCTGAAAGCCAACCTCAT 60 272
  R: GCTGCTCATAGGTGACAAACAT   
ACOX F: AGGTTCAGTCGGGGAAGCTGG 60 433
  R: ATCTGAGCCCCTGTGATGATG   
FAS F: GCTGCGGAAACTTCAGGAAAT 60 84
  R: AGAGACGTGTCACTCCTGGACTT   
ACC F: CACTGTGAACATGTGGAGG 60 155
  R: AGGCTGATGGTGATGACC   
β-Actin F: GGGTCAGAAGGACTCCTATG 60 90
  R: GTAACAATGCCATGTTCAAT   
  1. Sequences with bold font mean CpG site in the primers.