Skip to main content

Table 1 qPCR oligonucleotides and RT-qPCR efficiencies for Caco-2 cells

From: PPARγ as a sensor of lipase activity and a target for the lipase inhibitor orlistat

Gene name /(genebank accession no.) Primer and probe sequences
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase (NM_002046.3) F: AGCCACATCGCTCAGACAC
R: GCCCAATACGACCAAATCC
ACTB, β-actin (NM_005345.4) F: GGAGTCCTACGCCTTCAACA
R: CCAGCACCTTCTTCTTGTCG
hBD1, Human β defensin 1 (X92744.1) F: TGTCTGAGATGGCCTCAG GT
R: GGGCAGGCAGAATAGAGACA
ADRP, Adipose Differentiation Related Protein (NM_001122.2) F: TCAGCTCCATTCTACTGTTCACC
R: CCTGAATTTTCTGATTGGCACT
PPARγ variant 1 (NM_138712.3) F: GACAGGAAAGACAACAGACAAATC
  R: GGGGTGATGTGTTTGAACTTG