Skip to main content

Table 1 Real-time RT-PCR primers used for the quantification of human mRNAs

From: Oxidized eicosapentaenoic acids more potently reduce LXRα-induced cellular triacylglycerol via suppression of SREBP-1c, PGC-1β and GPA than its intact form

Gene name Reference or Accession number Forward (from 5’ to 3’) Reverse (from 5’ to 3’)
SREBP-1c [45] GGAGGGGTAGGGCCAACGGCCT CATGTCTTCGAAAGTGCAATCC
SCD-1 NM_005063 TGGTTTCACTTGGAGCTGTG GGCCTTGGAGACTTTCTTCC
FAS [45] CAGGGACAACCTGGAGTTCT CTGTGGTCCCACTTGATGAGT
ACC1 NM_198834 ATCCCGTACCTTCTTCTACTG CCCAAACATAAGCCTTCACTG
ABCA1 [46] GCAAGGCTACCAGTTACATTTG GTCAGAAACATCACCTCCTG
GPA NM_020918 TTGGGTTTGCGGAATGTTAT GGCAGAACCATCAGGGTTTA
PGC-1β NM_133263 TGACTCCGAGCTCTTCCAG CGAAGCTGAGGTGCATGATA
18S [45] TAAGTCCCTGCCCTTTGTACACA GATCCGAGGGCCTCACTAAAC