Skip to main content

Table 5 Primer sequences of 3’-UTR-C188T and G501C

From: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population

SNPs Primer sequences
3’-UTR-C188T Forward: 5’ TTAGGAGTGTGAGGGGAAGGTGA 3’
  Reverse: 5’ CCTTTGCAGAAACTGGGGTTCC 3’
G501C Forward: 5’ TGTCCGTCCAAGGTCATACACAA 3’
  Reverse: 5’ CCTTGTCCGCAAGACTGGATCT 3’