Skip to main content

Table 6 The probes for LDR

From: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population

SNPs The probe for LDR
3’-UTR-C188T FA: TGTTCGTGGGCCGGATTAGTGCTTGGGACAAGCTAGGTGAAATAATACTGA
  FG:TCTCTCGGGTCAATTCGTCCTTGCTTGGGACAAGCTAGGTGAAATAATACTGG
  FP: TAGCTAGAATCAAAAATGTTGACATAAAGGTGTTTTTTTTTTTTTTTTTTTT
G501C RC: TCTCTCGGGTCAATTCGTCCTTTCGGGCTCATTTAACTGGGAACAG
  RG: TGTTCGTGGGCCGGATTAGTTCGGGCTCATTTAACTGGGAACAC
  RP: AGCCAAGAGAAGTGCTTGTCTTTGTTTTTTTTTTTTTT
  1. LDR, ligation detection reaction.