Skip to main content

Table 1 Primers used for real-time PCR analysis

From: Chronic unpredictable mild stress combined with a high-fat diets aggravates atherosclerosis in rats

Gene Primer Sequence (5′→3′)
LCAT Sense TGTAGCCACACGTAGCACTG
Anti-sense AGGCACCCAGTAGGATAGCA
CYP7A1 Sense GGAAAAGCTGGCTGAGGGAT
Anti-sense TCAAAGGTGGAGAGCGTGTC
LXRα Sense TACAATGTGCTGAGCTGCGA
Anti-sense TGTAGCGGTCTCCCTTGATG
SR-B1 Sense CCCCATGAACTGTTCCGTGA
Anti-sense CCACAGCAATGGCAGGACTA
ABCG5 Sense GGGAAGTGTTTGTGAACGGC
Anti-sense GTGTATCTCAGCGTCTCCCG
ABCG8 Sense ACGTGGACTTGACGAGCATT
Anti-sense GTGTCCTGTGTGAGGGTCTG
GAPDH Sense TGCTGGGGCTGGCATTGCTCTC
Anti-sense ATGAGGTCCACCACCCTGTTGC