Skip to main content

Table 1 Primers for quantitative polymerase chain reaction

From: Linoleate appears to protect against palmitate-induced inflammation in Huh7 cells

Gene Forward/reverse Sequence 5′-3′
IL8 Forward ACACTGCGCCAACACAGAAATTA
  Reverse TTTGCTTGAAGTTTCACTGGCATC
TNFα Forward GTGACAAGCCTGTAGCCCATGTT
  Reverse TTATCTCTCAGCTCCACGCCATT
GAPDH Forward GCACCGTCAAGGCTGAGAAC
  Reverse TGGTGAAGACGCCAGTGGA