Skip to main content

Table 1 Methods and primers used in genotyping of TAFI −438 A/G, +1583 A/T, −1690 A/G and −2345 2G/1G polymorphisms

From: Association between polymorphisms in the flanking region of the TAFI gene and atherosclerotic cerebral infarction in a Chinese population

Gene polymorphisms Analysis Primers
TAFI −438 A/G PCR-RFLP Forward:ACCAATGGGAATGTAGG
Reverse:CCTTGCCTCTGACTTTT
TAFI +1583 A/T PCR-RFLP Forward:CTTGGCATGTCATTAGG
Reverse:TGCGGCATTTGTTGACA
TAFI −1690 A/G AS-PCR Common Forward a:CACCTGTAGACTTTTGC
Special Forward a1:TTAACTATTTTGACTGTTTA
Special Forward a2:TTAACTATTTTGACTGTTTG
Common Reverse b: CACTGAAGGAGAGAAAG
TAFI −2345 2G/1G AS-PCR Common Forward a:CACCTCAACTGGACTATGT
Special Forward a1:AGTTTTTAAAACATGAAAGA
Special Forward a2:AGTTTTTAAAACATGAAAGGA
Common Reverse b: TGTTCCCTTGCAGTTTAGC