Skip to main content

Table 1 Primers for iNOS and β-actin. Primers for iNOS and β-actin were designed by Primer Express®2.0 (Applied Biosystems). iNOS, inducible nitric oxide synthase.

From: Inducible nitric oxide synthase links NF-κB to PGE2 in polyunsaturated fatty acid altered fibroblast in-vitro wound healing

Gene Genebank accession # Start positions Primer sequences (5' ? 3') Amplicon length (bp)
iNOS U43428 2407 AGGGAATCTTGGAGCGAGTTGT 103
   2509 AGCCTCTTGTCTTTGACCCAGT  
β-actin X03672 886 TGGAATCCTGTGGCATCCATGA 91
   976 AGCACTGTGTTGGCATAGAGGT