Skip to main content

Table 1 The primer Sequences Used for PCR Amplification

From: Effect of hyperlipidemia on the expression of circadian genes in apolipoprotein E knock-out atherosclerotic mice

Gene Genebank
Accession No.
Annealing temperature Primer sequence 5' to 3'
Per2 NM_011066 58°C Forward Primer: CAGACTCATGATGACAGAGG
Reverse Primer: GAGATGTACAGGATCTTCCC
Bmal1 NM_007489 62°C Forward Primer: CACTGACTACCAAGAAAGTATG
Reverse Primer: ATCCATCTGCTGCCCTGAGA
Clock NM_007715 58°C Forward Primer: CTTCCTGGTAACGCGAGAAAG
Reverse Primer: TCGAATCTCACTAGCATCTGACT
Cry1 NM_007771 58°C Forward Primer: CACTGGTTCCGAAAGGGACTC
Reverse Primer: CTGAAGCAAAAATCGCCACCT
Rev-Erbα NM_145434 61°C Forward Primer: TACATTGGCTCTAGTGGCTCC
Reverse Primer: CAGTAGGTGATGGTGGGAAGTA
PPARα NM_011144 61°C Forward Primer: TCGGCGAACTATTCGGCTG
Reverse Primer: GCACTTGTGAAAACGGCAGT
RXRα NM_009024 61°C Forward Primer: CTGCACTCTCCTATCAGCACC
Reverse Primer: AGTCCCGAAGCCCAATGTG
GAPDH BC_083149 62°C Forward Primer: ACAGCCGCATCTTCTTGTGCAGTA
Reverse Primer: GGCCTTGACTGTGCCGTTGAATTT