Skip to main content

Table 2 Primers used for real-time PCR.

From: Reduced levels of SCD1 accentuate palmitate-induced stress in insulin-producing β-cells

Target Forward primer Reverse primer
β-actin GTTACAGGAAGTCCCTCACC GGAGACCAAAGCCTTCATAC
SCD1 CTTCTTGCGATACACTCTGG TGAATGTTCTTGTCGTAGGG