Skip to main content

Table 2 Gene specific forward and reverse primer sequences used for RT-PCR

From: Suppressive actions of eicosapentaenoic acid on lipid droplet formation in 3T3-L1 adipocytes

Gene Forward primer (5' - 3') Reverse primer (5' - 3') NCBI accession number
Adiponectin AAGGACAAGGCCGTTCTCT TATGGGTAGTTGCAGTCAGTTGG NM_009605
Cidea TGCTCTTCTGTATCGCCCAGT GCCGTGTTAAGGAATCTGCTG NM_007702
Cyclophilin TCTGCTGTCTTTGGAACTTTGTC CTGATGGCGAGCCCTTG NM_008907
D9D/SCD1 ATGCCGGCCCACATGCTCCAA TCAGCTACTCTTGTGACTCCC NM_009127
GLUT4 TGTGGCCTTCTTTGAGATTGG CTGAAGAGCTCGGCCCACAA NM_009204
HSL CCTACTGCTGGGCTGTCAA CCATCTCGCACCCTCACT NM_010719
IL-6 ACAAGTCGGAGGCTTAATTAGACAT TTGCCATTGCACAACTCTATTC NM_031168
Leptin TCCAGAAAGTCCAGGATGACAC CACATTTTGGGAAGGCAGG NM_008493
LPL AGTAGACTGGTTGTATCGGG AGCGTCATCAGGAGAAAGG NM_008509
MCP-1 CTTCCTCCACCACCATGCA CCAGCCGGCAACTGTGA NM_011333
Perilipin A TGCTGGATGGAGACCTC ACCGGCTCCATGCTCCA NM_001113471
PPARγ GGAATGGGAGTGGTCATCCA CCCACCAACTTCGGAATC NM_001127330