Skip to main content

Advertisement

Table 3 Primer sequences for quantitative analysis of the degree of DNA methylation using the MassARRAY system

From: Obesity induced by a pair-fed high fat sucrose diet: methylation and expression pattern of genes related to energy homeostasis

Gene Forward primer (5'→ 3') Reverse primer (3'→ 5')
GCK TAGAATTAGGGAGGAAGTAGGAAGG GGATTTTGAGGTATTGTATTGATTTTT
HADHB TTTTTTTATTAGTAGGAAAAGGGTAGT GGGTTGATTTTTGAATAAGATTTGA