Skip to main content

Table 5 PCR primers and conditions.

From: Preventive effects of chronic exogenous growth hormone levels on diet-induced hepatic steatosis in rats

Gene Primer Annealing tempertaure°C Product size (bp)
ob-rb F: TGCTCGGAACACTGTTAAT 58 171
  R: GAAGAAGAGCAAATATCA   
adipoR2 F: GGATGTGGAAGTCGTGTGTG 56 218
  R: ACCTGGTCAAACGAGACACC   
resistin F: ACTTCAGCTCCCTACTGCCA 60 273
  R: CTCAGTTCTCAATCAACCGTCC   
beta-actin F: GTACCCAGGCATTGCTGACA 56 169
  R: TCCTGCTTGCTGATCCACATC   
  1. Ob-rb: the full-length leptin receptor isoform; AdipoR2: adiponectin receptor 2.