Skip to main content

Table 1 Primers used for quantitative real-time polymerase chain reaction (PCR)

From: Prevention and treatment effect of total flavonoids in Stellera chamaejasme L. on nonalcoholic fatty liver in rats

Gene Primer pairs Sequence( 5′ → 3′) GenBank no Product length(bp)
CYP7A1 Sense primer AAAGCGGGAAAGCAAAGACCA NM_012942 157
Antisense primer AGTTCAAAGCAGGAGAGCATCAGG   
CPT-1 Sense primer CCGCAAACTGGACCGAGAAGAGAT AF029875 185
Antisense primer TTTGCCTGGGATGCGTGTAGTGTT   
PPAR-α Sense primer TACCTGTGAACACGATCTGA NM_013196 136
Antisense primer GCTAGTCTTTCCTGCGAGTA   
PPAR-γ Sense primer TGTGGGGATAAAGCATCAGC NM_001145366 175
Antisense primer CAAGGCACTTCTGAAACCGA   
SREBP-1c Sense primer AGGAGGCCATCTTGTTGCTT AF286470 126
Antisense primer GTTTTGACCCTTAGGGCAGC   
ACC Sense primer GGAAGACCTGGTCAAGAAGAAAAT NM_022193 142
Antisense primer CACCAGATCCTTATTATTGT   
β-actin Sense primer GGCACCACACTTTCTACAAT NM_031144 123
Antisense primer AGGTCTCAAACATGATCTGG   
Leptin Sense primer TGCCTATCCACAAAGTCCAG NM_013076.2 381
Antisense primer TGCTCAGAGCCACCACCT   
FAS Sense primer CGGCGTGTGATGGGGCTGGTA NM_017332 145
Antisense primer AGGAGTAGTAGGCGGTGGTGTAGA