Skip to main content

Table 5 Primers for gene expression analysis

From: Long-term effect of early postnatal overnutrition on insulin resistance and serum fatty acid profiles in male rats

Genes Forward primer (5’ → 3’)
Reversed primer (5’ → 3’)
Irs-1 GTGCCAAGCAACAAGAAAGC
  TCAGAGCAGAGGAACCGTAT
Akt2 CCACGACCCAACACCTTT
  CCTTGCTGACCGCTACCT
Glut4 (Slc2a4) GGCTGTGAGTGAGTGCTTT
  GGTTTCTGCTCCCTATCGT
Gapdh GGCACAGTCAAGGCTGAGAATG
  ATGGTGGTGAAGACGCCAGTA