Skip to main content

Table 2 Oligonucleotide primers used for quantitative real-time polymerase chain reaction

From: High dietary cholesterol and ovariectomy in rats repress gene expression of key markers of VLDL and bile acid metabolism in liver

Gene Oligo FWD Oligo REV
MDR2 ggcattctccatcatcctgt cacttctgttgctttactgtgtca
BSEP cggtggctgagagatcaaat tgcgatagtggtggagaaca
ABCG5 cggagagttggtgttctgtg caccgatgtcaagtccatgt
ABCG8 cagatgctggctatcataggg ctgatttcatcttgccacca
ACAT-2 cctcacagatgcgtttcaca ctctgctcacttgccattttt
Apob gatggagatgggagatgaggt gggctcctcatcaacaagag
Cideb gctccaatggcctgctaag ttatgatcacagacacggaagg
Cyp7a1 ggagcttatttcaaatgatcagg cactctgtaaagctccactcactt
DGAT-2 aggatctgccctgtcacg gtcttggagggccgagag
HMG-CoAr caaccttctacctcagcaagc acagtgccacacacaattcg
LDLr tgctactggccaaggacat ctgggtggtcggtacagtg
LRP-1 aatcgagggcaagatgacac ccagtctgtccagtacatccac
Mttp gcgagtctaaaacccgagtg cactgtgatgtcgctggttatt
FXR ccacgaccaagctatgcag tctctgtttgctgtatgagtcca
Sar1a gggcaaaccacaggaaag cactgcacatgaacacttcca
SREBP-2 gtgcagacagtcgctacacc aatctgaggctgaaccagga
NTCP aaaatcaagcctccaaaggac ttgtgggtacctttttccaga
ActB cccgcgagtacaaccttct cgtcatccatggcgaact
GAPDH ccctcaagattgtcagcaatg agttgtcatggatgaccttgg