Skip to main content

Table 1 Sequences of primers for quantitative real-time RT-PCR

From: Adiponectin improves NF-κB-mediated inflammation and abates atherosclerosis progression in apolipoprotein E-deficient mice

Genes Forward Reverse
β-actin 5′- GCTCTTTTCCAGCCTTCCTT -3′ 5′-CTTCTGCATCCTGTCAGCAA-3′
APN 5′- AGGTTGGATGGCAGGC -3′ 5′-TCTCACCCTTAGGACCAAGAA-3′
eNOS 5′- TGTCTGCGGCGATGTCACT -3′ 5′- CATGCCGCCCTCTGTTG -3′
TNF-α 5′-GTCCCCAAAGGGATGAGAAG-3′ 5′- CACTTGGTGGTTTGCTACGA-3′
IL-6 5′-CCGGAGAGGAGACTTCACAG-3′ 5′-TCCACGATTTCCCAGAGAAC-3′
VCAM-1 5′-GCCCTCACTTGCAGCACTAC-3′ 5′-TCCTCACCTTCGCGTTTAGT-3′
IL-10 5′-GCTCTTACTGACTGGCATGAG-3′ 5′-CGCAGCTCTAGGAGCATGTG-3′