Skip to main content

Table 3 Primers used for real-time PCRa

From: Effects of Bacillus licheniformis on the growth performance and expression of lipid metabolism-related genes in broiler chickens challenged with Clostridium perfringens-induced necrotic enteritis

Gene Genbank number Primers position Primers sequnce (5' to 3') Annealing temperature(°C) References
ACC NM_205505 Forward AATGGCAGCTTTGGAGGTGT 60.9 [23]
Reverse TCTGTTTGGGTGGGAGGTG
FAS J03860 Forward CTATCGACACAGCCTGCTCCT 62.0 [23]
Reverse CAGAATGTTGACCCCTCCTACC
CPT-1 AY675193 Forward CAATGAGGTACTCCCTGAAA 57.5 [26]
Reverse CATTATTGGTCCACGCCCTC
PPAR-α AF163809 Forward TGGACGAATGCCAAGGTC 60.3 [26]
Reverse GATTTCCTGCAGTAAAGGGTG
SREBP-1c AY029224 Forward GAGGAAGGCCATCGAGTACA 60.3 [26]
Reverse GGAAGACAAAGGCACAGAGG
ACOX1 NM_001006205 Forward ATGTCACGTTCACCCCATCC 54.0 [21]
Reverse AGGTAGGAGACCATGCCAGT
GADPH NM_204305 Forward GGTGAAAGTCGGAGTCAACGG 58.4 [57]
Reverse CGATGAAGGGATCATTGATGGC
  1. a ACC, acetyl-CoA carboxylase; FAS, fatty acid synthase; CPT-1, carnitine palmitoyl transferase 1; PPAR-α, peroxisome proliferator activated receptor-alpha; SREBP-1c, sterol regulatory element binding protein 1; ACOX1, acyl CoA oxidase 1; GADPH, glyceraldehyde 3-phosphate dehydrogenase