Skip to main content

Advertisement

Table 2 Characteristics of primers used for qPCR

From: Conjugated linoleic acid influences the metabolism of tocopherol in lactating rats but has little effect on tissue tocopherol concentrations in pups

Gene GeneBank accession no. Sense primer (5′-3′) Antisense primer (5′-3′) Product size, bp Primer efficiency Annealing Temp., °C
Reference genes
 ACTB NM_031144.2 GACCTCTATGCCAACACAGT CACCAATCCACACAGAGTAC 154 1.92 60
 ATP5B NM_134364.1 GCACCGTCAGAACTATTGCT GAATTCAGGAGCCTCAGCAT 203 1.90 60
 CANX NM_172008.2 CCAGATGCAGATCTGAAGAC CTGGGTCCTCAATTTCACGT 175 2.31 60
 MDH1 NM_033235.1 CAGACAAAGAAGAGGTTGCC CGTCAGGCAGTTTGTATTGG 206 1.97 60
 RPL13 NM_031101.1 CTTAAATTGGCCACGCAGCT CTTCTCAACGTCTTGCTCTG 198 1.94 60
 TOP1 NM_022615.1 GAAGAACGCTATCCAGAAGG GCTTTGGGACTCAGCTTCAT 137 2.00 60
 YWHAZ NM_013011.3 GACGGAAGGTGCTGAGAAA GCAGCAACCTCAGCCAAGT 198 2.09 60
Target genes
 TTPA NM_013048.2 GGAGGTGGAAACTCAACGGAA AGCAGCAATCTTCTTGGCTACA 109 1.93 60
 CYP3A1 NM_013105.2 TGGTAATAGACTTGAGAGAG GGGCAGATATACATAAGGA 196 1.90 56
 LDLR NM_175762.2 ACAGTGTCCTCCCAAGTCCAA GCAAATGTGGATCTCGTCCTC 222 1.87 60
 SCARB1 NM_031541.1 GGTGCCCATCATTTACCAAC CCCTACAGCTTGGCTTCTTG 162 1.94 60
 LPL NM_012598.2 GAGATTTCTCTGTATGGCACA CTGCAGATGAGAAACTTTCTC 276 1.99 60
  1. Primers were designed using Primer3 from gene sequences obtained from GeneBank and tested in silico using BeaconDesigner and mfold. Primer specificity was determined using a BLAST search