Skip to main content

Table 1 Primer design for genes analyzed by real-time PCR

From: The role of expression imbalance between adipose synthesis and storage mediated by PPAR-γ/FSP27 in the formation of insulin resistance in catch up growth

SYBR Green RT-PCR Primers Forward Primer Reverse primer Annealing temperature
PPAR-γ TGTCGGTTTCAGAAGTGCCTTG TTCAGCTGGTCGATATCACTGGAG 60 °C
FSP-27 AAGGCATCATGGCCCACAG TCTCCACGATTGTGCCATCTTC 58 °C
SIRT-1 TCCTCACTAATGGCTTTCATTCCTG GTGCCAATCATGAGATGTTGCTG 57 °C
β-Actin GGAGATTACTGCCCTGGCTCCTA GACTCATCGTACTCCTGCTTGCTG 62 °C