Skip to main content

Table 1 Sequences for real-time PCR primers

From: Mammary inflammatory gene expression was associated with reproductive stage and regulated by docosahexenoic acid: in vitro and in vivo studies

Gene   Primer sequences (5′-3′) Product size Genebank Accession
IL-1β Forward TGACCTGTTCTTTGAGGCTGAC 113 bp M98820.1
  Reverse CGAGATGCTGCTGTGAGATTTG   
TNF-α Forward CCACTCTGACCCCTTTACTCTGA 154 bp NM_013693.2
  Reverse CTGTCCCAGCATCTTGTGTTTC   
IL-8 Forward CCAGCAGGAAACCAGAAGAAAG 123 bp NM_001173399.2
  Reverse CAACTTTGTCACGACCATACCC   
IL-6 Forward TGAACTCCCTCTCCACAAGC 74 bp NM_001252429.1
  Reverse GGCAGTAGCCATCACCAGA   
LBP Forward GGCTTCCTTGCTCCTGTCAT 177 bp NM_001128435.1
  Reverse GTTGGTGGTCAGTCGGATGT   
TLR4 Forward TCAGTTCTCACCTTCCTCCTG 166 bp XM_013986843.1
  Reverse GTTCATTCCTCACCCAGTCTTC   
MYD88 Forward GATGGTAGCGGTTGTCTCTGAT 148 bp NM_001099923.1
  Reverse GATGCTGGGGAACTCTTTCTTC   
αS1-casein Forward ACAAATGAGGACAAGCATACCC 175 bp NM_001004029.2
  Reverse GAGGGATGTTGGTGAATAATGG   
GAPDH Forward CTACAGCAACAGGGTGGTGGA 179 bp NM_001206359.1
  Reverse GGATGGAAACTGGAAGTCAGG