Skip to main content

Table 1 Primers used in this study

From: Bisphenol A promotes cholesterol absorption in Caco-2 cells by up-regulation of NPC1L1 expression

Primer Name Sequence
NPC1L1-F 5’-TATG GTCGCCCGAAGCA-3
NPC1L1-R 5’-TGCGGTTGTTCTGGAA ATACTG-3’
SREBP-2-F 5’-CAGCAGCCTTTGATATACCAGAATG -3’
SREBP-2-R 5’- AGGATGTCACCAGGCTTTGGAC -3’
GAPDH-F 5’-CATGAGAAGTATGACAACAGCCT-3’
GAPDH-R 5’-AGTCCTTCCACGATACCAAAGT-3’