Skip to main content

Table 2 Real-time quantitative PCR primer sequences

From: Protective effects of various ratios of DHA/EPA supplementation on high-fat diet-induced liver damage in mice

Gene Forward primer 5′–3′ Reverse primer 5′–3′
AMPK GCCATGCGCAGACTAGTT AGGATGTATGGCCGATCTTC
SREBP-1 GTGAGCCTGACAAGCAATCA GGTGCCTACAGAGCAAGAGG
PPARγ TTTCAAGGGTGCCAGTTT GAGGCCAGCATCGTGTAG
PPARα CCTCAGGGTACCACTACGGAGT GCCGAATAGTTCGCCGAA
ACC-l TACTGAACTACATCTTCTCCC AAGCAATAAGAACCTGACGA
FAS CAAATACAATGGCACCCTGA TGGCGAAGCCGTAGTTAGTT
SCD-1 GAATTCATGCCTGCGCACTTGCTACA CTCGAGTCAGCCGCTCTTGTGACTCC
CPT-1 TTAACAGCAACTACTACGCC CCAGAAGACGAATAGGTTTGAG
HSL GCCACAATGACACAGTCACTGGT CAGGCAGCGGCCGTAGAAGCA
ACOX GGTGGCTGTTAAGAAGAGTG AAGATGAGTTCCATGACCCA
c-Jun ATGACTGCAAAGATGGAAACG AAGTTGCTGAGGTTGGCG
c-Fos TACTACCATTCCCCAGCC GCTCTACTTTGCCCCTTC
Fra1 TCATCTGGAGAGGTGGGTCC CTGCGGTTCTGACTCACTCG
TNF-α AGCCCCCAGTGTGTATCCTT ACAGTCCAGGTCACTGTCCC
IL-1β CTTCAGGCAGGCAGTATCACTC TTGTTGTTCATCTCGGAGCC
IL-6 AGTTGCCTTCTTGGGACTGA TCCACGATTTCCCAGAGAAC
β-actin TTCGTTGCCGGTCCACACCC GCTTTGCACATGCCGGAGCC