Skip to main content

Table 1 Primers sets used for qPCR

From: Liquid chromatography mass spectrometry-based profiling of phosphatidylcholine and phosphatidylethanolamine in the plasma and liver of acetaminophen-induced liver injured mice

Gene name Genbank accession NM Primer (5′-3′)
Actb NM_007393.5 Forward: CGTGCGTGACATCAAAGAGAA
Reverse: GCTCGTTGCCAATAGTGATGA
Pla1a NM_134102.4 Forward: GGACTTTCTGTACTGCCCCT
Reverse: CGCAGGCTATTTTCAGGTCC
Pla2g12a NM_001286948.1 Forward: GAAGCCTGTTCCACGCTATG
Reverse: CACTTGGTCAGGGAAGGGAT
Pnpla2 NM_001163689.1 Forward: ATGGTGCCCTATACTCTGCC
Reverse: TCTTCAGGGACATCAGGCAG
Plcg1 NM_021280.3 Forward: CCAGCAGAGAAACATGGCTC
Reverse: TCTTCCTCCTGAGCTGGTTG
Pld3 NM_001317355.1 Forward: TAAAGGTTCGCATCGCTGTG
Reverse: CTGATCCACCACCCAGAACT
Pla2g12b NM_023530.2 Forward: GGTGTCGATATGGAAAGGCG
Reverse: AACACTTGGTCATTGCTGGG
Pnpla7 NM_146251.4 Forward: ATCAAACAACGCCTGGGTTC
Reverse: GCCTGATACAGCACAATCCG
Plcxd2 NM_001134480.1 Forward: CTTCATCCACGGGCTCTTTG
Reverse: TCTTGAGGGTGCTGAGTGAG
Pld4 NM_178911.4 Forward: CAAGTGCCCATGAAACAGCT
Reverse: GCACCAAGTTCCTTCACCTG
Pla2g6 NM_001199023.1 Forward: GTCCTGCTGCTCTGTAATGC
Reverse: TCCTTGCTGTGGATCTGGTT
Pnpla8 NM_026164.2 Forward: TGGTGGAGGAACAAGAGGTG
Reverse: TATGGCCCCTGTGCTTACTC
Pla2g15 NM_133792.2 Forward: GGCCTCCTGTTACCTCTGTT
Reverse: GGTTACCCAAATCACCAGGC
Pla2g7 NM_013737.5 Forward: CAGCTCAAGATCAAGGTCGC
Reverse: CAGCTTGCAGGAGTTGTCAG
Pemt NM_001290011.1 Forward: CGAGATGGGAGCAGAGAACT
Reverse: ATCTTGGGCTGGCTCATCAT
Lpcat3 NM_145130.2 Forward: CCAGGGAAGATGCCAAACAG
Reverse: TAGTCGTCTGTGATGTGGGG
Chka NM_001271496.1 Forward: CTTCGCGAGGACCAGTTC
Reverse: CTATGGAGTCTGGCAGGGAG
Pcyt2 NM_024229.2 Forward: TGGTGCGATGGCTGCTATG
Reverse: CCCTTATGCTTGGCAATCTCC
Pisd NM_177298.3 Forward: CATACTGCTCCTGTCCGATCC
Reverse: TTCCGTTCCCTGTACTTCTCATA
Etnk1 NM_029250.2 Forward: TGAGGATTTACGGCAACAAGAC
Reverse: CAGTCCGTTATTAAAGGTGCAGT
Etnk2 NM_175443.5 Forward: CGGTGGAACAGGACGACATC
Reverse: AGGCCAATAGCTTGTTGGTGA
Chkb NM_007692.6 Forward: GCCGAGCCTATCAGTGGTG
Reverse: GTAGTGAGCATCGGAAGAGCA