Skip to main content

Advertisement

Table 1 Primers and amplicons for detecting ETFDH gene mutation

From: Compound heterozygous mutations in electron transfer flavoprotein dehydrogenase identified in a young Chinese woman with late-onset glutaric aciduria type II

Name Sequence of primers Amplicon(bp)
ETFDH-Exon1-F CAATCGATCTCGAAGGGCACT 659 bp
ETFDH--Exon1-R TTAATTCTACCAACTGGGGCAAC
ETFDH--Exon2-F GTTAAGCCTGACATGAGCTAAATTG 537 bp
ETFDH--Exon2-R TAATTGTCGTGTTGTTGACTGAAGG
ETFDH--Exon3-F TGTGCAAAACACAGGGAGAATTTC 512 bp
ETFDH--Exon3-R AGCCTGGGCAACAAGAGTGAAA
ETFDH--Exon4-F AGGAGAAACACTTGAACCCAGGA 502 bp
ETFDH--Exon4-R AGTAAGTCCTTCAAATATCTGGGTCTC  
ETFDH--Exon5-F TGAAAGTGTGACCATCAATGTAGCA 437 bp
ETFDH--Exon5-R TTGATGGGGGTACAACATGAGGA  
ETFDH--Exon6-F CTTTCTCATCAAGGTTGTGGCAT 405 bp
ETFDH--Exon6-R TTGGAGAGATGGGGTTTCACTTT  
ETFDH--Exon7-F CCATTGGCAGAGGAGCTGGAT 683 bp
ETFDH--Exon7-R CAACACTTGATACGACAATTCCAAC  
ETFDH--Exon8-F CACCGTGCCCAGCCTTCTT 477 bp
ETFDH--Exon8-R AATGACACAGCAGCCATAAGCACT  
ETFDH--Exon9-F CCAGAGCACAAGGATTTCTTAATATG 693 bp
ETFDH--Exon9-R ATTTGTTGTAGAGATGGGGTTTCG  
ETFDH—Exon10-F ATTTTTCAGCCTTTCCCTACAGC 551 bp
ETFDH—Exon10-R GCCTACCAAAGTGCTGGGATTAC  
ETFDH—Exon11-F CCAACCTGGGTGACAGAGCAA 580 bp
ETFDH—Exon11-R CTTCAACAATTTTGAGGGAAATGCT  
ETFDH—Exon12-F TGAGGGCTAGTCATATTTCTTTGGT 444 bp
ETFDH—Exon12-R TTTCTAAGGAATGGAAGGAGATACAG  
ETFDH—Exon13-F TGAGAGGATGACTGTGAATAAGGGA 689 bp
ETFDH—Exon13-R GAACTGAAGAGGTAGGAAGATGCTG