Association between apolipoprotein B genetic polymorphism and the risk of calcific aortic stenosis in Chinese subjects, in Xinjiang, China

Table 1 The primer sequences for each SNP

SNPs	Polymerase chain reaction primers	Denaturation temperature	Product length	Restriction enzyme
Rs6725189	Sense 5′TATTCCCTATTATGTTGTGG3′	51.3 °C	788	Ace I
Rs6725189	Antisense 5′CTTGAAGGTGGACTGGTT 3′	51.3 °C	788	Ace I
Rs693	Sense 5′GGAAAGCCTACAGGACAC3′	51.3 °C	290	FnuA I
Rs693	Antisense 5′TCATACGTTTAGCCCAAT3′	51.3 °C	290	FnuA I

ISSN: 1476-511X