Skip to main content

Table 1 Primer sequences for Quantitative PCR.

From: Heat shock protein 70 promotes lipogenesis in HepG2 cells

HSPA1A Sense 5′-3’ CCACCATTGAGGAGGTAGATTAG
Antisense 5′-3’ TCATCTCTGCATGTAGAAACCG
FAS Sense 5′-3’ AAGGACCTGTCTAGGTTTGATGC
Antisense 5′-3’ TGGCTTCATAGGTGACTTCCA
SCD Sense 5′-3’ GCCCCTCTACTTGGAAGACGA
Antisense 5′-3’ AAGTGATCCCATACAGGGCTC
ACC Sense 5′-3’ TCACACCTGAAGACCTTAAAGCC
Antisense 5′-3’ AGCCCACACTGCTTGTACTG
PPARα Sense 5′-3’ ATGGTGGACACGGAAAGCC
Antisense 5′-3’ CGATGGATTGCGAAATCTCTTGG
SREBP1C Sense 5′-3’ CGGAACCATCTTGGCAACAGT
Antisense 5′-3’ CGCTTCTCAATGGCGTTGT
ACOX Sense 5′-3’ GGAACTCACCTTCGAGGCTTG
Antisense 5′-3’ TTCCCCTTAGTGATGAGCTGG
CPT-1 Sense 5′-3’ TCCAGTTGGCTTATCGTGGTG
Antisense 5′-3’ TCCAGAGTCCGATTGATTTTTGC
GAPDH Sense 5′-3’ CCATGTTCGTCATGGGTGTGAACCA
Antisense 5′-3’ GCCAGTAGAGGCAGGGATGATGTTC