Skip to main content

Table 1 PCR primer sequences used in this study

From: Polymorphism of CONNEXIN37 gene is a risk factor for ischemic stroke in Han Chinese population

SNP Primer name Sequence 5′ to 3′
rs1764391 Forward GTCTTCTTCTACCTCCCCGTG
rs1764391 Reverse TTCTCAGGACCCCTCTGTTGG
rs1764390 Forward TGACGGTGCTCTTCATCTTCC
rs1764390 Reverse GGTGTGCTGACGAAGAGGAAC