Skip to main content

Table 2 Probe sequences used in this study

From: Polymorphism of CONNEXIN37 gene is a risk factor for ischemic stroke in Han Chinese population

SNP Probe name Sequence 5′ to 3′
rs1764391 TC CCACCCCCTCAGAATGGCCAAAAAC
rs1764391 TT TTTCCACCCCCTCAGAATGGCCAAAAAT
rs1764391 TR p-CCCCAAGTCGTCCCAGCAGCTCTGC-FAM
rs1764390 TA TTTTCGAGTCAGTGTGGGGTGACGAGCAA
rs1764390 TG TTTTTTTCGAGTCAGTGTGGGGTGACGAGCAG
rs1764390 TR p-TCAGATTTCGAGTGTAACACGGCCCTTT-FAM