Skip to main content

Table 1 Sequences of primers used for real-time PCR

From: p62 is linked to mitophagy in oleic acid-induced adipogenesis in human adipose-derived stromal cells

Gene Primer (5′ → 3′)
Forward Reverse
PPARG AGCCTCATGAAGAGCCTTCCA ACCCTTGCATCCTTCACAAGC
ACTB ACTCTTCCAGCCTTCCTTCC GTACTTGCGCTCAGGAGGAG
ND1 CCCTAAAACCCGCCACATC GAGCGATGGTGAGAGCTAAGGT
GAPDH ATGGGGAAGGTGAAGGTCG GGGGTCATTGATGGCAACAATA