Skip to main content

Table 1 Primers for RT-PCR. PCR was performed using the primers indicated as below under optimal amplification condition (95 °C for 5 min; 22–35 cycles of 95 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s; 72 °C for 7 min) for each gene

From: Apigetrin inhibits adipogenesis in 3T3-L1 cells by downregulating PPARγ and CEBP-α

Name Forward Revoerse
GAPDH 5′-TGGTGAAGGTCGGTGTGAACGG-3′ 5′-TGCCGTTGAATTTGCCGTGAGT-3′
PPARγ 5′-AAACTCTGGGAGATTCTCCT-3′ 5′-TGGCATCTCTGTGTCAAC-3′
C/EBPα 5′-GCCAAACTGAGACTCTTC-3′ 5′-TGGCATCTCTGTGTCAAC-3′
SREBP-1c 5′-GCTTAGCCTCTACACCAACTGGC-3′ 5′-ACAGACTGGTACGGGCCACAAG-3′
FAS 5′-TGGAGCCTGTGTAGCCTTCGAG-3′ 5′-ACAGCCTGGGGTCATCTTTGCC-3′
IL-6 5′- GGTGACAACCACGGCCTTCCC -3’ 5′- GCCACTCCTTCTGTGACTCCAGC -3’
TNF-α 5′- AAATGGGCTCCCTCTCATCAGTTC-3’ 5′- TCTGCTTGGTGGTTTGCTACGAC-3’