Skip to main content

Table 3 Primer sequences

From: Down-regulation of microsomal prostaglandin E2 synthase-1 in the infrapatellar fat pad of osteoarthritis patients with hypercholesterolemia

Primer Sequence (5′–3′) Product size (bp)
COX-2-F TGGCTGAGGGAACACAACAG 74
COX-2-R AACAACTGCTCATCACCCCA
mPGES1-F GGAGACCATCTACCCCTTCCT 81
mPGES1-R AAGTGCATCCAGGCGACAAA
TNF-α-F CCCATCCCATCTTCCACAGG 74
TNF-α-R GGTGGTCTTATCCCCAACCC
IL-1β-F GTACCTGTCCTGCGTGTTGA 153
IL-1β-R GGGAACTGGGCAGACTCAAA
IL-6-F GAGGAGACTTGCCTGGTGAAA 199
IL-6-R TGGCATTTGTGGTTGGGTCA
GAPDH-F TGTTGCCATCAATGACCCCTT 202
GAPDH-R CTCCACGACGTACTCAGCG