Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primer sequences used in this study

From: Effects of oral selenium and magnesium co-supplementation on lipid metabolism, antioxidative status, histopathological lesions, and related gene expression in rats fed a high-fat diet

Target genes Forward (5’-3’) Reverse (5’-3’)
GAPDH GCAAGTTCAACGGCACAG CGCCAGTAGACTCCACGAC
HMG-CoA-R TGTGGGAACGGTGACACTTA CTTCAAATTTTGGGCACTCA
LDLR AGCCGATGCATTCCTGACTC AGTTCATCCGAGCCATTTTCAC
CYP7A1 ACGTGGTTGGAAGAAGCG GAATGTGGGCAGCGAGAA
ACAT GCTGAAGTGAACTACCCCTT GAGCCATGCCTCTAGTACCT
LCAT CCCAAGGCTGAACTCAGTAACCA CGGTAGCACAGCCAGTTTACCA
DGAT2 GAGACTACTTTCCCATCCAG GGTATCCAAAGATATAGTTCCT
LXRα ACAACCCTGGGAGTGAGA TAGCATCCGTGGGAACAT
PPARγ TTGATTTCTCCAGCATTTC GCTCTACTTTGATCGCACT
PPARα CCTGGCCTTCTAAACATAGG TCCCTGCTCTCCTGTATGGG
FASN CTGGACTCGCTCATGGGTG CATTTCCTGAAGTTTCCGCAG