Skip to main content

Table 1 Oligonucleotide sequence 5' → 3'

From: Resveratrol ameliorates maternal and post-weaning high-fat diet-induced nonalcoholic fatty liver disease via renin-angiotensin system

Gene of interest Forward Reverse
SIRT1 5' TGGAGCAGGTTGCAGGAATCCA 5' TGGCTTCATGATGGCAAGTGGC
AT1R 5' ACCAGGTCAAGTGGATTTCG 5' ATCACCACCAAGCTGTTTCC
AT2R 5' CAATCTGGCTGTGGCTGACTT 5' TGCACATCACAGGTCCAAAGA
ACE1 5' CACCGGCAAGGTCTGCTT 5' CTTGGCATAGTTTCGTGAGGAA
ACE2 5' GCCAGGAGATGACCGGAAA 5' CTGAAGTCTCCATGTCCCAGATC
MAS 5' CATCTCTCCTCTCGGCTTTGTG 5' CCTCATCCGGAAGCAAAGG
Renin 5' AACATTACCAGGGCAACTTTCACT 5' ACCCCCTTCATGGTGATCTG
Angiotensionogen 5' GTGTGATGCCTCCTGTGTA 5' TGCTGCTCATCATTTATTCTCAGTTA
Leptin receptor 5' ACTGGGACATAGAGTGCTGG 5' GTTGCACTGGACAGTCTGAA
GAPDH 5' TAAAGAACAGGCTCTTAGCACA 5' AGTCTTGGAAATGGATTGTCTC