Skip to main content

Table 1 Primers used for transcript quantification by real-time PCR

From: MicroRNA-217 attenuates intima–media complex thickness of ascending aorta measured by ultrasound bio-microscopy and inhibits inflammation and lipid metabolism in atherosclerotic models of ApoE−/− mice

Name Sequence
MiR-217 FOR: ACACTCCAGCTGGGTACTGCATCAGGAAC
REV: TGGTGTCGTGGAGTCG
β-actin FOR: CTGGGACGACATGGAGAAAA
REV: GACCAGGTTGCCCATCACT
F4/80 FOR: TCTGGGGAGCTTACGATGG
REV: TAGGAATCCCGCAATGATGG
TNF-α FOR: GCCACCACGCTCTTCTGTC
REV: TGCTCCTCCACTTGGTGGTT
IL-1 FOR: TTGACGGACCCCAAAAGATG
REV: AGCTGCCACAGCTTCTCCAC
IL-6 FOR: CCATCCAGTTGCCTTCTTGG
REV: TGCAAGTGCATCATCGTTGT
MCP-1 FOR: AGGTCCCTGTCATGCTTCTG
REV: TCTGGACCCATTCCTTCTTG
CD36 FOR: GAGCAACTGGTGGATGGTTT
REV: GCAGAATCAAGGGAGAGCAC
LDL-R FOR: CCCACATCTGCAAGGACCTC
REV: CTATGGAGCCCACAGCCTTG
ABCA1 FOR: GAACAGCTCCAGCTCCTCCA
REV: TCCACGTCTTCCTCGGTGTT
ABCG1 FOR: CCTCACCCAGTTCTGCATCC
REV: AGGGCAGCAAACATGAGGAA
SR-A1 FOR: CCTTCATTCAAGGGCCTCCT
REV: CTCCTGGGTTTCCTCGACCT
SR-B1 FOR: CAAGCAGCAGGTGCTCAAGA
REV: GGTTCTCCACGAAGGACACG