Skip to main content

Table 4 Primers used for RT-PCR

From: Lavandula stoechas essential oils protect against Malathion-induces reproductive disruptions in male mice

Primer Primer Sequence (5′-3′) Tm (°c)
StAR Forward: GCCCCGAGACTTCGTAAG
Reverse: CAGGTGGGACCGTGTTCA
59
P450scc Forward: GCCCCGAGACTTCGTAAG
Reverse: CAGGTGGGACCGTGTTCA
60
3β-HSD Forward: CCTGCTGCGTCCATTTTA
Reverse: TCTGCTTGGCTTCCTCCC
60
17β-HSD Forward: ACCGCCGATGAGTTTGTT
Reverse: GGGTGGTGCTGCTGTAGA
60
β-Actin Forward: GAGATTACTGCCCTGGCTCCTA
Reverse: ACTCATCGTACTCCTGCTTGCTG
60