Skip to main content

Table 1 The primers of CHip-PCR

From: Adenovirus type 36 regulates adipose stem cell differentiation and glucolipid metabolism through the PI3K/Akt/FoxO1/PPARγ signaling pathway

Gene Primer sequence (5′ → 3′)
Human Pparγ-forward CCAGGAATAGACACCGAAAGA
Human Pparγ-reverse TGAGGGGCGTGAACGTACT
Human Acc-forward CGAACGCAGCAATCAAATAA
Human Acc-reverse CGTCCAGCCTTGACATCTG
Human Glut4-forward AAGACCAGTGAGGGTGATGG
Human Glut4-reverse CGCTCTCCTCGTTTATCCAG
Human Adipoq-forward GTGCTCCCTTCTGAAGCACT
Human Adipoq-reverse GAAGATGGGGCAAAAGTCAA
Human Lpin1-forward TTCACGCGAGACAGTGGTAG
Human Lpin1-reverse CTGTCTCCAGAGGAGGTTGG