Skip to main content

Table 1 Sequences of primers used for real-time PCR

From: Metformin regulates lipid metabolism in a canine model of atrial fibrillation through AMPK/PPAR-α/VLCAD pathway

Primer Forward (5′ → 3′) Reverse (5′ → 3′)
PPARα TAAAGAGCCTAAGGAAACCGTTC GCAAATGATAGCAGCCACAAA
CPT-1 AACCCGAACATTCCATACCC GAACGCACAGTCTCCGTCC
ACC AAAGGATTCCCGTACAAGCAG CAGTCCACCCGAAGACCACT
VLCAD CATAGCTGCTTTCTGTCTAACGG AGGCTTTGATGCCCATCTTC
GAPDH GAAGGTCGGAGTGAACGGATT CATTTGATGTTGGCGGGATC