Skip to main content

Advertisement

Table 1 The sgRNA sequences used in this study

From: Generation of an MC3R knock-out pig by CRSPR/Cas9 combined with somatic cell nuclear transfer (SCNT) technology

sgRNA Sequence (5′ → 3′)
sgRNA1 GCATTCATTGCTCACGGCCG GGG
sgRNA2 GGAGACCATCATGATCGCCG TGG
sgRNA3 GGCTCCGGAAGGCGTAGATC AGG
sgRNA4 CAGGCTAAGGACCGCTCCGG CGG
  1. Note: PAM sequences are underlined