Skip to main content

Table 1 Sequence of primers for quantitative real-time PCR

From: FoxO3 regulates hepatic triglyceride metabolism via modulation of the expression of sterol regulatory-element binding protein 1c

GeneSpeciesForward primerReverse primer
FoxO3HumanTCAAGGATAAGGGCGACAGCGGACCCGCATGAATCGACTA
SREBP-1cHumanGCGCCTTGACAGGTGAAGTCGCCAGGGAAGTCACTGTCTTG
SCD1HumanAGCTCATCGTCTGTGGAGCCGCCACGTCGGGAATTATGAGG
FASHumanGGGATGAACCAGACTGCGTGTCTGCACTTGGTATTCTGGGT
ACC1HumanATGTCTGGCTTGCACCTAGTACCCCAAAGCGAGTAACAAATTCT
CD36HumanCTTTGGCTTAATGAGACTGGGACGCAACAAACATCACCACACCA
MTTPHumanACAAGCTCACGTACTCCACTGTCCTCCATAGTAAGGCCACATC
PPARαHumanTTCGCAATCCATCGGCGAGCCACAGGATAAGTCACCGAGG
β-actinHumanGATGAGATTGGCATGGCTTTGTCACCTTCACCGTTCCAGT
FoxO3MouseCTCACTTTGTCCCAGATCTACGCTTCATTCTGAACGCGCATG
SREBP-1cMouseGTGAGCCTGACAAGCAATCAGGTGCCTACAGAGCAAGAG
ChREBPMouseAGATGGAGAACCGACGTATCAACTGAGCGTGCTGACAAGTC
SCD1MouseTTCTTGCGATACACTCTGGTGCCGGGATTGAATGTTCTTGTCGT
FASMouseGCTGCGGAAACTTCAGGAAATAGAGACGTGTCACTCCTGGACTT
ACC1MouseATGGGCGGAATGGTCTCTTTCTGGGGACCTTGTCTTCATCAT
GPAMMouseACAGTTGGCACAATAGACGTTTCCTTCCATTTCAGTGTTGCAGA
DGAT2MouseGCGCTACTTCCGAGACTACTTGGGCCTTATGCCAGGAAACT
SREBP-2MouseGCAGCAACGGGACCATTCTCCCCATGACTAAGTCCTTCAACT
HMGCS1MouseAACTGGTGCAGAAATCTCTAGCGGTTGAATAGCTCAGAACTAGCC
HMGCRMouseAGCTTGCCCGAATTGTATGTGTCTGTTGTGAACCATGTGACTTC
36B4MouseAGATTCGGGATATGCTGTTGGCTCGGGTCCTAGACCAGTGTTC