Skip to main content

Table 1 Sequence of primers for quantitative real-time PCR

From: FoxO3 regulates hepatic triglyceride metabolism via modulation of the expression of sterol regulatory-element binding protein 1c

Gene Species Forward primer Reverse primer
FoxO3 Human TCAAGGATAAGGGCGACAGC GGACCCGCATGAATCGACTA
SREBP-1c Human GCGCCTTGACAGGTGAAGTC GCCAGGGAAGTCACTGTCTTG
SCD1 Human AGCTCATCGTCTGTGGAGCC GCCACGTCGGGAATTATGAGG
FAS Human GGGATGAACCAGACTGCGTG TCTGCACTTGGTATTCTGGGT
ACC1 Human ATGTCTGGCTTGCACCTAGTA CCCCAAAGCGAGTAACAAATTCT
CD36 Human CTTTGGCTTAATGAGACTGGGAC GCAACAAACATCACCACACCA
MTTP Human ACAAGCTCACGTACTCCACTG TCCTCCATAGTAAGGCCACATC
PPARα Human TTCGCAATCCATCGGCGAG CCACAGGATAAGTCACCGAGG
β-actin Human GATGAGATTGGCATGGCTTT GTCACCTTCACCGTTCCAGT
FoxO3 Mouse CTCACTTTGTCCCAGATCTACG CTTCATTCTGAACGCGCATG
SREBP-1c Mouse GTGAGCCTGACAAGCAATCA GGTGCCTACAGAGCAAGAG
ChREBP Mouse AGATGGAGAACCGACGTATCA ACTGAGCGTGCTGACAAGTC
SCD1 Mouse TTCTTGCGATACACTCTGGTGC CGGGATTGAATGTTCTTGTCGT
FAS Mouse GCTGCGGAAACTTCAGGAAAT AGAGACGTGTCACTCCTGGACTT
ACC1 Mouse ATGGGCGGAATGGTCTCTTTC TGGGGACCTTGTCTTCATCAT
GPAM Mouse ACAGTTGGCACAATAGACGTTT CCTTCCATTTCAGTGTTGCAGA
DGAT2 Mouse GCGCTACTTCCGAGACTACTT GGGCCTTATGCCAGGAAACT
SREBP-2 Mouse GCAGCAACGGGACCATTCT CCCCATGACTAAGTCCTTCAACT
HMGCS1 Mouse AACTGGTGCAGAAATCTCTAGC GGTTGAATAGCTCAGAACTAGCC
HMGCR Mouse AGCTTGCCCGAATTGTATGTG TCTGTTGTGAACCATGTGACTTC
36B4 Mouse AGATTCGGGATATGCTGTTGGC TCGGGTCCTAGACCAGTGTTC