Skip to main content

Table 1 Primers sequences used for qPCR

From: CPT1a gene expression reverses the inflammatory and anti-phagocytic effect of 7-ketocholesterol in RAW264.7 macrophages

GeneForward primerReverse primer
GAPDHTGAAGCAGGCATCTGAGGGCGAAGGTGGAAGAGTGGGAG
CPT1aTTTGAATCGGCTCCTAATGGCCCAAGTATCCACAGGGTCA
CD36CAGCTCATACATTGCTGTTTATGCATGGGTACAATCACAGTGTTTTCTACGTGG
iNOSAGGGAATCTTGGAGCGAGTTGCAGCCTCTTGTCTTTGACC
NLRP3Assay ID: qMmuCID0010647. PrimePCR™ SYBR® Green Assay (Bio-Rad).
  1. GAPDH glyceraldehyde 3-phosphate dehydrogenase, CPT1a carnitine palmitoyl transferase 1-a, CD36 cluster of differentiation CD36, iNOS inducible nitric oxide synthase, NLRP3 NOD-like receptor pyrin domain-containing-3